View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_74 (Length: 252)
Name: NF1342_low_74
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_74 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 23917267 - 23917023
Alignment:
| Q |
1 |
ttgcttctggaactcactttcttctcgcaaccaactgacacacctttatcttttcgttccaacggtggaagtcgattttcaaaaccggaatgaagatttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
23917267 |
ttgcttctggaactcactttcttctcggaaccaactgacacacctttatcttttcgttctaacggtggaagtcgattttcaaaaccggaatgaagacttc |
23917168 |
T |
 |
| Q |
101 |
tctcttttttcttaaggctaagatgttgcaaaccctgcatgcttatagcttcatcctcgtaatcacatcnnnnnnnnnnnngaagtgatttatctaactg |
200 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| | || || | | ||||||||||||||||||| |
|
|
| T |
23917167 |
tttcttttttcttaaggctatgatgttgcaaaccctgcatgcttatagcttcatccacatagtcgcgccttttttctttttgaagtgatttatctaactg |
23917068 |
T |
 |
| Q |
201 |
aatttttccaatggactcaaattccctcgatttcattctctgctc |
245 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
23917067 |
aatttttccaatggactcaaattcccttgatttcattctgtgctc |
23917023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University