View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_78 (Length: 251)
Name: NF1342_low_78
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 223
Target Start/End: Complemental strand, 43363248 - 43363047
Alignment:
| Q |
22 |
aacacgattttgaatatgattatccacaaatttcatgtgttcaaatatacatttcattattcgtcaaaattatgttcaagtctaggtgatctccaggtgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43363248 |
aacacgattttgaatatgattatccacaaatttcatgtgttcaaatatacatttcattattcgtcaaaattatgttcaagtctaggtgatctccaggtgt |
43363149 |
T |
 |
| Q |
122 |
tcaaactttaaattcagatgatattcattaccacaatcttgagtacaaatacacacttgcaaattgtagttaataacgttcaaagtcatggtaaattata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43363148 |
tcaaactttaaattcagatgatattcattaccacgatcttgagtacaaatacacacttgcaaattgtagttaataacgttcaaagtcattgtaaattata |
43363049 |
T |
 |
| Q |
222 |
tt |
223 |
Q |
| |
|
|| |
|
|
| T |
43363048 |
tt |
43363047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University