View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_79 (Length: 250)
Name: NF1342_low_79
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 48586499 - 48586309
Alignment:
| Q |
18 |
attaaatgcagtatatcattttcagactataaatgctactgccgatcacaagtgctgttaggggctatttaacgtgacccttattacaatatcaaatgta |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48586499 |
attaaatgcaggatatcattttcagactataaatgctactgccgatcacaagtgctgttaggggctatttaacgtgacccttattacaatatcaaatgta |
48586400 |
T |
 |
| Q |
118 |
gaaatcagagtattaaactagtgtaaatttatttttcaaaaaattgaaaataa-nnnnnnnnncaatagatatttaacgtgacccttatta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48586399 |
gaaatcagagtattaaactagtgtaaatttatttttcaataaattgaaaataattttttttttcaatagatatttaacgtgacccttatta |
48586309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 48586265 - 48586217
Alignment:
| Q |
202 |
ttattattttctcttaactcctacggactaccacactttctagctacca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48586265 |
ttattattttctcttaactcctacggactaccacactttctagctacca |
48586217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 70
Target Start/End: Complemental strand, 48586549 - 48586517
Alignment:
| Q |
38 |
ttcagactataaatgctactgccgatcacaagt |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
48586549 |
ttcagactataaatgctactgctgatcacaagt |
48586517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University