View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_82 (Length: 243)
Name: NF1342_low_82
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 98 - 242
Target Start/End: Original strand, 30643489 - 30643633
Alignment:
| Q |
98 |
aggtattgcctgttgatagtttgcttttttgtttcatgtaaagcttccatggttagggacacgccactggaggtgtttgttgaaagttgtcgaaaatgtg |
197 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30643489 |
aggtgttgcctgttgatagtttgcgtttttgtttcatgtaaagcttccatggttagggacacgcaactggaggtgttcgttgaaagttgtcgaaaatgtg |
30643588 |
T |
 |
| Q |
198 |
gatatgtgatgaaggcaacaaccaacaatgagtaatgagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30643589 |
gatatgtgatgaaggcaacaacaaacaatgagtaaagagtataat |
30643633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University