View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_91 (Length: 211)
Name: NF1342_low_91
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_91 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 7e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40094058 - 40093926
Alignment:
| Q |
1 |
gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40094058 |
gtttcaaaaacgactgtggcacgtggtatctgtgagatgagattaatgtctcaatcacatcatagatcaagattttttttctcatgtttaaactcttctt |
40093959 |
T |
|
| Q |
101 |
cattgaaaatttgcaacacttacaatgtctgtg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40093958 |
cattgaaaatttgcaacacttacaatgtctgtg |
40093926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40063426 - 40063295
Alignment:
| Q |
1 |
gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt |
100 |
Q |
| |
|
||||||||||||| |||| || ||||||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||||||||| || |
|
|
| T |
40063426 |
gtttcaaaaacgatcgtggtacatggtatctgcgagatgggattaatgtctcagtcacatcgtagatcaagatttttttt-tcatgtttaaactcttttt |
40063328 |
T |
|
| Q |
101 |
cattgaaaatttgcaacacttacaatgtctgtg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40063327 |
cattgaaaatttgcaacacttacaatgtctgtg |
40063295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 40081776 - 40081646
Alignment:
| Q |
1 |
gtttcaaaaacgactgtggcacgtggtatctgtgagatgggattaatgtcgcagtcacatcatagatcaagannnnnnnnctcatgtttaaactcttctt |
100 |
Q |
| |
|
||||||||||||| |||| || ||||||||| ||||| ||||| |||| |||| |||||||||||||||| | |||||||||| || || |
|
|
| T |
40081776 |
gtttcaaaaacgatcgtggtacatggtatctgcaagatgcgattattgtctcagtaacatcatagatcaagattattttctt--tgtttaaacttttttt |
40081679 |
T |
|
| Q |
101 |
cattgaaaatttgcaacacttacaatgtctgtg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40081678 |
tattgaaaatttgcaacacttacaatgtctgtg |
40081646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University