View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1342_low_92 (Length: 208)
Name: NF1342_low_92
Description: NF1342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1342_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 78 - 171
Target Start/End: Complemental strand, 1760172 - 1760079
Alignment:
| Q |
78 |
tcattttcattgtcaccaccaccatcaaaaccaggcatgacaccacaagatccattttcattttcattgtcaccaccaccatcaacaccaggcg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1760172 |
tcattttcattgtcaccaccaccatcaaaaccaggcatgacaccacaagatccattttcattttcattgtcaccaccaccatcaacaccaggcg |
1760079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 23 - 113
Target Start/End: Complemental strand, 1760170 - 1760080
Alignment:
| Q |
23 |
attttcattgtcaccaccaccatcaaaaccaggcatgacaccacaagatccattttcattttcattgtcaccaccaccatcaaaaccaggc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1760170 |
attttcattgtcaccaccaccatcaaaaccaggcatgacaccacaagatccattttcattttcattgtcaccaccaccatcaacaccaggc |
1760080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University