View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13430_low_7 (Length: 299)
Name: NF13430_low_7
Description: NF13430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13430_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 10 - 281
Target Start/End: Original strand, 19505028 - 19505304
Alignment:
| Q |
10 |
gagtgagatgaatgggtatatgtagaggattcttgagccaaagaagtattggaccttgtgagtgtcca------ccttatgtccaattcagaacacataa |
103 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||| ||| |
|
|
| T |
19505028 |
gagtgagaagaatgggtatatgtagaggattcttgagccaaagaagtattggacctcttgagtgtccaacttgaccttatggccaattcagaacatgtaa |
19505127 |
T |
 |
| Q |
104 |
tatataatatttgatacatcgataacatagattacacggnnnnnnnttgtgtggttggtttaaatttaaggtaaaaagcatatggatgt--gggggttta |
201 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||| | |||| ||| |
|
|
| T |
19505128 |
tatataatatatg---catcgataacatagattacaccaaaaaaatatgtgtggttgttttaaatttaaggtaaaaaacatatggatatatggggaatta |
19505224 |
T |
 |
| Q |
202 |
gtgcctctttcttttattttccattttctcatcttttaaacaaattattagtgtttcaaatttcttgattgtaaaatttg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19505225 |
gtgcctctttcttttattttccattttctcatcttttaaacaaattattagtgtttcaaatttcttgattgtaaaatttg |
19505304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University