View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13430_low_9 (Length: 221)
Name: NF13430_low_9
Description: NF13430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13430_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 46413426 - 46413240
Alignment:
| Q |
20 |
tttaaagtcctaatcaattttcagttattcccctgatcagattatttgga----ggcatttgaagtagttgaccatgtcagacgaaaaagatgatgtaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46413426 |
tttaaagtcctaatcaattttcagttattcccctgatcagattatttggacacagccatttgaagtagttgaccatgtcagacgaaaaagatgatgtaat |
46413327 |
T |
|
| Q |
116 |
caagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaaaggaagggaagatagtggagtaag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
46413326 |
caagtggtacttgcctttccagcagagtaaattctttggcaaagagacagggttggacaagaaaggaagggatggcagtggagtaag |
46413240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University