View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13431_low_10 (Length: 263)
Name: NF13431_low_10
Description: NF13431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13431_low_10 |
 |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 33 - 255
Target Start/End: Original strand, 10736485 - 10736707
Alignment:
| Q |
33 |
gataaggagtttgttgtttgtcgccattgaagaatctaaaagctgctaatttctcttctgttgttgatcgtgtttgtctgtttattttttgttactgttt |
132 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10736485 |
gataaggagtttgttgtttgaggccattgaagaatctaaaagctgctaatttctcttctgttgttgatcgtgtttgtttgtttattttttgttggtgttt |
10736584 |
T |
 |
| Q |
133 |
aattgattatgggtatttgttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttgggatgttggtgtgttgttgcagga |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10736585 |
aattgattatgggtatttgttgatttggggatgttgctgactatttggatatttgtgagaaaaatgtattgatttgggatgttggtgtgttgttgcagga |
10736684 |
T |
 |
| Q |
233 |
agggagaaaagagaatgatgatg |
255 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10736685 |
agggagaaaagagaatgatgatg |
10736707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 150 - 255
Target Start/End: Complemental strand, 7351 - 7246
Alignment:
| Q |
150 |
tgttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttggg-atgttggtgtgttgttgcaggaagggagaaaagagaat |
248 |
Q |
| |
|
||||||||||||| ||||| ||||||||||| ||||||||| |||| ||||||||||||| || ||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
7351 |
tgttgatttgggggtgttg-tggctatttgggtatttgtgaaaaaagggtattgatttggggatattgttgtgttattgaaggaagggagaaaagagaat |
7253 |
T |
 |
| Q |
249 |
gatgatg |
255 |
Q |
| |
|
||||||| |
|
|
| T |
7252 |
gatgatg |
7246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 182 - 255
Target Start/End: Original strand, 26802914 - 26802988
Alignment:
| Q |
182 |
tatttgtgagaaaaatgtattgatttggg-atgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
255 |
Q |
| |
|
||||||||| |||| |||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26802914 |
tatttgtgaaaaaagagtattgatatggggatgttgctgtgttgttgcaggaagggagaaaagagaatgatgatg |
26802988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 255
Target Start/End: Original strand, 40110370 - 40110417
Alignment:
| Q |
208 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
255 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110370 |
gggatgttgctgtgttgttgcaggaagggagaaaagagaatgatgatg |
40110417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 255
Target Start/End: Complemental strand, 24516724 - 24516677
Alignment:
| Q |
208 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
255 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24516724 |
gggatgttgttgtgttgttgcaggaagggagaaaagagaacgatgatg |
24516677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 255
Target Start/End: Complemental strand, 41348637 - 41348590
Alignment:
| Q |
208 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgatgatg |
255 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41348637 |
gggatgttgttgtgttgttgcaggaagggagaaaagagaatgatgatg |
41348590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 247
Target Start/End: Original strand, 11968160 - 11968256
Alignment:
| Q |
152 |
ttgatttggggatgttgctggctatttggatatttgtgagaaaaatgtattgatttg-ggatgttggtgtgttgttgcaggaagggagaaaagagaa |
247 |
Q |
| |
|
|||||||||| | ||||||| |||||| ||||||||| |||| ||||||||||| |||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
11968160 |
ttgatttgggatttttgctggttatttgagtatttgtgaaaaaagggtattgatttgaggatgttgttgtgttgttgtaggaagggagaagagagaa |
11968256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 22620859 - 22620902
Alignment:
| Q |
208 |
gggatgttggtgtgttgttgcaggaagggagaaaagagaatgat |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22620859 |
gggatgttgctgtgttgttgcaggaagggagaaaagagaatgat |
22620902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University