View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13431_low_9 (Length: 265)
Name: NF13431_low_9
Description: NF13431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13431_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 255
Target Start/End: Complemental strand, 7554327 - 7554091
Alignment:
| Q |
19 |
aaggatagaagctccgcctgcatgggattggagttacgaaaagaaggaactctactcgcgccatggatgtgttgttcactagtattctgaaatgctctgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554327 |
aaggatagaagctccgcctgcatgggattggagttacgaaaagaaggaactctactcgcgccatggatgtgttgttcactagtattctgaaatgctctgc |
7554228 |
T |
 |
| Q |
119 |
cgaagttcaaactctaaaatgtcaaatgtttcnnnnnnnacagatttacttctgttagaatttacttttttaatgtcagttatgataagaatgttataac |
218 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7554227 |
cgaagttcaaactctaaaatgtcaaatttttctttttttacagatttacttctgttagaatttacttttttaatgtcagttatgataagaatgttataac |
7554128 |
T |
 |
| Q |
219 |
tttgtattctctgtagtgtttcttttatattcttgga |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |
|
|
| T |
7554127 |
tttgtattctctgtagtgtttcttttatgttgttgga |
7554091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University