View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13432_high_4 (Length: 408)
Name: NF13432_high_4
Description: NF13432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13432_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 5e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 215 - 401
Target Start/End: Complemental strand, 31120071 - 31119884
Alignment:
| Q |
215 |
atatcaactatgattatactaaatgttggatata--ataaagacgatccatatattcaataccttataaatgataccgagatagactagtagttattaca |
312 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| ||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
31120071 |
atatcaactatgattaaactaaatgttagatatataataaagacgatccatatattcgataccttataa-tgatattgagatagactagtagttattaca |
31119973 |
T |
|
| Q |
313 |
gttttgaccataactagaatagacacttagatcttttagatggaggaagttttgtgtggtctcaataatttggacatattcttcgacat |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||| |
|
|
| T |
31119972 |
gttttgaccataactagaatagacacttagatcttttagatggaggaagttttgcgtggtctcaataatttggacataatattcgacat |
31119884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 175 - 214
Target Start/End: Original strand, 13465371 - 13465410
Alignment:
| Q |
175 |
ttcattataataatattttgttatattcataatatgatta |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13465371 |
ttcattataataatattttgttatactcataatatgatta |
13465410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University