View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13432_low_11 (Length: 266)
Name: NF13432_low_11
Description: NF13432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13432_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 30337583 - 30337831
Alignment:
| Q |
1 |
cataaatctctggttaggaaagaaaaagaatgatagtttctgatataagc----acttttggctcaaaggcttttttcttttataatgtcttgtttgttt |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30337583 |
cataaatctctggttgggaaagaaaaagaatgatagtttctgatataagcaagcacttttggctcaaaggcttttttcttttataatgtcttgtttgttt |
30337682 |
T |
 |
| Q |
97 |
gaattccctaaagtcacttgtttgttgtgacacctgaaattgcagatatgtactgtaatttcagagatttaattactagtttcctttatgttgtaagcct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30337683 |
gaattccctaaagtcacttgtttgttgtaacacctgaaattccagatatgtactgtaatttcagtgatttaattactagtttcctttatgttgtaagcct |
30337782 |
T |
 |
| Q |
197 |
tgagagccaattaagaagttaatcaaaaattagaattgttttattattctg |
247 |
Q |
| |
|
| |||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
30337783 |
t--gagccaattaagaagttaatgaaaaatttgaattgttttattattctg |
30337831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 29 - 71
Target Start/End: Original strand, 30325962 - 30326004
Alignment:
| Q |
29 |
aatgatagtttctgatataagcacttttggctcaaaggctttt |
71 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
30325962 |
aatgatagtttctcataaaagcacttttggctcaaaggctttt |
30326004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 30321812 - 30321862
Alignment:
| Q |
176 |
tttcctttatgttgtaagccttgagagccaattaagaagttaatcaaaaatta |
228 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
30321812 |
tttcctttatattgtaagccttgag--ccaattaagaagttaatgaaaaatta |
30321862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 30333492 - 30333556
Alignment:
| Q |
51 |
acttttggctcaaaggcttttttcttttataatgtcttgtttgtttgaattccctaaagtcacttgtt |
118 |
Q |
| |
|
||||||||||||||||||||| || ||| | |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
30333492 |
acttttggctcaaaggctttta-ctattaaa--gtctcgtttgtttgaatgccctaaagtcacttgtt |
30333556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University