View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13432_low_2 (Length: 601)
Name: NF13432_low_2
Description: NF13432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13432_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 5e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 5e-73
Query Start/End: Original strand, 20 - 167
Target Start/End: Original strand, 24032290 - 24032437
Alignment:
| Q |
20 |
cgtagatgatggataagacacggtaagtaggaaatagtatttgatatcacaggacgcggataaacttagcaaacttgctattttcttagatattattttg |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24032290 |
cgtagatgatggataagacacagtaagtaggaaatagtatttgatatcacaggacgtggataaacttagcaaacttgctattttcttagatattattttg |
24032389 |
T |
|
| Q |
120 |
tggcgacctaagcttttgaactttgtggagcaagaggccactgttatt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24032390 |
tggcgacctaagcttttgaactttgtggagcaagaggccactgttatt |
24032437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 2e-60
Query Start/End: Original strand, 429 - 555
Target Start/End: Original strand, 24032431 - 24032557
Alignment:
| Q |
429 |
tgtttttgtttaaagagtgctactgaagagattcgtacgtgttttgttttaatcaaccattttggtattgcgggtctgttagactctggcctgagctcgt |
528 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24032431 |
tgttattgtttaaagagtgctactgaagagattcgtacttgttttgttttaatcaaccattttggtattgcgggtctgttagactctggcctgagctcgt |
24032530 |
T |
|
| Q |
529 |
tatcagtttagatgttgtcttctgttt |
555 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
24032531 |
tatcagtttagatgttgtcttctgttt |
24032557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 561 - 594
Target Start/End: Original strand, 24032550 - 24032583
Alignment:
| Q |
561 |
ttctgttttgttgttccgaacagtttcctttgct |
594 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24032550 |
ttctgttttgttgttccgaacagtttcctttgct |
24032583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University