View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13433_high_7 (Length: 243)
Name: NF13433_high_7
Description: NF13433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13433_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 8587870 - 8587668
Alignment:
| Q |
19 |
caatcttctgcgtcgtcgttttagttaccttagctcttttcacacttaactccaattctacctctacaattcgaa---tttccaacgtcgtttttgatgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8587870 |
caatcttctgcgtcgtcgttttagttaccttagctcttttcacacttaactccaattctagctctacaattcgaagaatttccaacgtcgtttttgatgg |
8587771 |
T |
|
| Q |
116 |
tcctccaaaaatcgcttttttattcctcgttcgtcaaaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8587770 |
tcctccaaaaatcgcttttttattcctcgttcgtcaaaatattccccttgattttctctggggtgctttctttcaggttccttcaatttcctctgcctct |
8587671 |
T |
|
| Q |
216 |
ttt |
218 |
Q |
| |
|
||| |
|
|
| T |
8587670 |
ttt |
8587668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University