View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13433_low_5 (Length: 321)
Name: NF13433_low_5
Description: NF13433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13433_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 42105170 - 42104874
Alignment:
| Q |
18 |
cagtcagctgcaattcgaaaatcacaccattcttcatagatggctgaaatggaagaaattgggtatgtatcaaaacttctattatcannnnnnnnnnatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42105170 |
cagtcagctgcaattcgaaaatcacaccattcttcatagatggctgaaatggaagaaattgggtatgtatcaaaacttctattatcattttgtttttatt |
42105071 |
T |
 |
| Q |
118 |
gtttgaaaattcaatattctgctaagaccaactaaatcggggaccatatatccatcagaaaccctaaatgttctgtctcaacacaacacatgaattgttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42105070 |
gtttgaaaattcaatattctgctaagaccaactaaatcagggaccatatatccatcagaaaccctaaatgttctgtctcaacacaacacatgaattgttg |
42104971 |
T |
 |
| Q |
218 |
acaccttgcgaatgtggattaaaatgtcatatggtccttcaccaccatgtcaaccctagggtttctannnnnnngtttgtttgttgaagatcctatg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |
|
|
| T |
42104970 |
acaccttgcgaatgtggattaaaatgtcatatggtccttcaccaccatgtcaaccctagggtttctatttttttgtctgtttgttgaagaacctatg |
42104874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University