View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13433_low_6 (Length: 319)
Name: NF13433_low_6
Description: NF13433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13433_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 23 - 215
Target Start/End: Complemental strand, 38608799 - 38608607
Alignment:
| Q |
23 |
tacagaagcttaacgagttcatattgatttgttcaattcaggaatctaaaaaggagaagagcagtgactttaaatatgatgggcctggatggattattct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38608799 |
tacagaagcttaacgagttcatattgatcttttcaattcaggaatctaaaaaggagaagagcagtgactttaaatatgacgggcctggatggattattct |
38608700 |
T |
|
| Q |
123 |
tgctgtagggatagtagcatgtgcgatattattctcaaaattatcggtgaaagacaattcattttaggttgaagttgtgaaacaaagtattgt |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38608699 |
tgcagtagggatagtagcatgtgcgatattattctcaaaattatcagtgaaagacaattcattttaggttgaagttgtgaaacaaagtattgt |
38608607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 53 - 143
Target Start/End: Complemental strand, 38603625 - 38603535
Alignment:
| Q |
53 |
gttcaattcaggaatctaaaaaggagaagagcagtgactttaaatatgatgggcctggatggattattcttgctgtagggatagtagcatg |
143 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| |||| |||||| || ||||||| ||||||||| | ||| ||||||||||| |
|
|
| T |
38603625 |
gttcatttcaggaatctaaaaagcagaagagcagtgagtttacatatgacttgcttggatgggctattcttgcagcaggtatagtagcatg |
38603535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 216 - 255
Target Start/End: Complemental strand, 38608553 - 38608514
Alignment:
| Q |
216 |
aattctcaacctcttgaatcattgttcctaataattgtga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38608553 |
aattctcaacctcttgaatcattgttcctaatagttgtga |
38608514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University