View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13435_low_8 (Length: 288)
Name: NF13435_low_8
Description: NF13435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13435_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 22362691 - 22362425
Alignment:
| Q |
1 |
tgaatgtcgtccatgcatcctgttacaaaatagaaaacgtgaacttaaggacccatttacttctaatattattttttgcttttcaaaatgcattttataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362691 |
tgaatgtcgtccatgcatcctgttacaaaatagaaaacgtgaacttaaggacccatttacttctaatattattttttgcttttcaaaatgcattttataa |
22362592 |
T |
 |
| Q |
101 |
aacaatgagtattatttaaaattctgaataaatttcaaaatattattttcatattatctttggttattactaatactatcacaattcaaaataaaaattc |
200 |
Q |
| |
|
| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362591 |
accaatgagtgttatttaaaattcttaataaatttcaaaatattattttcatattatctttggttattactaatactatcacaattcaaaataaaaattc |
22362492 |
T |
 |
| Q |
201 |
ataataaattgtcatcccagcaaaccatagagaaaatagaatttaaaaatgaaaattgaaaaggttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362491 |
ataataaattgtcatcccagcaaaccatagagaaaatagaatttaaaaatgaaaattgaaaaggttg |
22362425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University