View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13436_high_9 (Length: 343)
Name: NF13436_high_9
Description: NF13436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13436_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 13 - 334
Target Start/End: Original strand, 6485854 - 6486175
Alignment:
| Q |
13 |
actttgacggttctgtcccatgaagcagagtagaggtaggttttgtctggagaaaggcttaggcatgaaactgcatccgaatgtttgatccataatgcag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6485854 |
actttgacggttctgtcccatgaagcagagtagaggtaggttttgtctggagaaagacttaggcatgaaactgcatccgaatgtttgatccataatgcag |
6485953 |
T |
|
| Q |
113 |
ttcggtgttttctaacctcgacataattgcttggtttaatcgagcttttgaagatgtctttgagtgttggtaatgttccggcacgtttgtgaacgctagg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6485954 |
ttcggtgttttctaacctcgacataattgcttggtttaattgagcttttgaagatgtctttgagtgttggtaatgttccagcacgtttgtgaacgctagg |
6486053 |
T |
|
| Q |
213 |
gttcttgagagaaactttccaaacacggattttaccgtcttggtgaccagtgaagatcttttgaccggatattatgattgctttcaccagtccactgttg |
312 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486054 |
gttcttgagagagactttccaaacacggattttaccgtcttggtgaccagtgaagatcttttgaccggatattatgattgctttcaccagtccactgttg |
6486153 |
T |
|
| Q |
313 |
gatttgaatccgcaatattctt |
334 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6486154 |
gatttgaatccgcaatattctt |
6486175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University