View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13436_low_15 (Length: 298)

Name: NF13436_low_15
Description: NF13436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13436_low_15
NF13436_low_15
[»] chr4 (1 HSPs)
chr4 (8-260)||(39630170-39630424)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 39630170 - 39630424
Alignment:
8 tgagatgaagcctagagcataccaaatatttttagaggtcgtataatctctaatacaatgaagaaggtttcttcagaagaggaacaacgaggatagatat 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39630170 tgagatgaagcctagagcataccaaatatttttagaggtcgtataatctctaatacaatgaagaaggtttcttcagaagaggaacaacgaggatagatat 39630269  T
108 cgcttggagcaaggtttcagtggctta-gagggaaatgg--tatcgacaaagatgttaataaaagccattcaaacaagaaattttannnnnnnnatgaag 204  Q
    ||||||||||||||||||||||||||| |||||| ||||  ||| |||||||||||||||||||||||||||||||||||||||||        ||||||    
39630270 cgcttggagcaaggtttcagtggcttaggagggacatggtatatggacaaagatgttaataaaagccattcaaacaagaaatttta-tttttttatgaag 39630368  T
205 ttcgaggctcgaaatctaagaccatgagataaaggcaatacatgcacgaaatttta 260  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39630369 ttcgaggctcgaaatctaagaccatgagataaaggcaatacatgcacgaaatttta 39630424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University