View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13436_low_17 (Length: 265)
Name: NF13436_low_17
Description: NF13436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13436_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 31910455 - 31910689
Alignment:
| Q |
12 |
atgaaatacgaaaacaacttttatctcattttgtaacacaatttagactataaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaatt |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910455 |
atgaaatacgagaacaacttttatctcattttataacacaatttagactatcaatagtcagttaattgcaaccaaaattgtgagaaaactgaagggaatt |
31910554 |
T |
|
| Q |
112 |
aagtcttcttctcaaagtaaccaaaatcacttaaaaatgacatgtatattaaaagttatacggaaaatactatcaagatgtccaaaatacgagttgaaat |
211 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| ||| |
|
|
| T |
31910555 |
aagtcttcttctcaatgtaactaaaatcacttaaaaatggcatgtatattaaaagttatacgg-aaatactatcaagatatccaaaatacgatttgcaat |
31910653 |
T |
|
| Q |
212 |
attttatataaatcaataaatttagcatggtctttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31910654 |
attttatataaatcaataaatttagcatgatctttg |
31910689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University