View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13437_low_12 (Length: 215)
Name: NF13437_low_12
Description: NF13437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13437_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 29 - 199
Target Start/End: Complemental strand, 48308961 - 48308791
Alignment:
| Q |
29 |
tcttgctgatattctttttgaggcataggtgattattggtcttcctccgtgcaacttttttcaatatatggacaatactagaattggataatccttggct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48308961 |
tcttgctgatattctttttgaggcataggtgattattggtcttcctccgtgcaacttttttcaatatatggacaatactagaattggataatccttggct |
48308862 |
T |
|
| Q |
129 |
gctgtttacttctgatagatagacctttgattgttaatttgttgtctctttagtttatactactaagatat |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48308861 |
gctgtttacttctgatagatagacccttgattgttaatttgttgtctctttagtttatagtactaagatat |
48308791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University