View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13438_high_11 (Length: 231)
Name: NF13438_high_11
Description: NF13438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13438_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 64 - 218
Target Start/End: Original strand, 9722118 - 9722272
Alignment:
| Q |
64 |
ttaagggaatattgtaattgaaggttagtttcgcataattacaatgtattatcatgattatgcgtatgtttgattatgtggtagcgagaattgattttga |
163 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9722118 |
ttaaggaaatactgtaattgaaggttagtttcgcataattacaatgtattatcatgattatgcgtatgtttgattatgtggtagcgagaattgattttga |
9722217 |
T |
 |
| Q |
164 |
ttgaactaattttgttgaagggattctgaccaaattgagttgaatataacttttt |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9722218 |
ttgaactaattttgttgaatggattctgaccaaattgagttgaatataacttttt |
9722272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 9722059 - 9722101
Alignment:
| Q |
1 |
aaccgtacctcgagtctaattactttcgtaggagagaatctat |
43 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9722059 |
aaccgtgcctcgagtctaattactttcgtaggagagaatctat |
9722101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 23526244 - 23526297
Alignment:
| Q |
125 |
gcgtatgtttgattatgtggtagcgagaattgattttgattgaactaattttgt |
178 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
23526244 |
gcgtatgtttgattgtgtggtagaaagaattgattttgatagaacttattttgt |
23526297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University