View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13438_low_11 (Length: 273)

Name: NF13438_low_11
Description: NF13438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13438_low_11
NF13438_low_11
[»] chr2 (1 HSPs)
chr2 (63-222)||(13742155-13742314)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 63 - 222
Target Start/End: Complemental strand, 13742314 - 13742155
Alignment:
63 aatctctgagcgagtctcttccgttgtcttgtcctaacatacattgtaaaccttttgtttctgcagacttgctttcagacaatgtatggctttatggaaa 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13742314 aatctctgagcgagtctcttccgttgtcttgtcctaacatacattgtaaaccttttgtttctgcagacttgctttcagacaatgtatggctttatggaaa 13742215  T
163 gagaaaattggacacacgaccattgatttaggaatagccccagaaaaactagaatcctat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13742214 gagaaaattggacacacgaccattgatttaggaatagccccagaaaaactagaatcctat 13742155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University