View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13438_low_11 (Length: 273)
Name: NF13438_low_11
Description: NF13438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13438_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 63 - 222
Target Start/End: Complemental strand, 13742314 - 13742155
Alignment:
| Q |
63 |
aatctctgagcgagtctcttccgttgtcttgtcctaacatacattgtaaaccttttgtttctgcagacttgctttcagacaatgtatggctttatggaaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13742314 |
aatctctgagcgagtctcttccgttgtcttgtcctaacatacattgtaaaccttttgtttctgcagacttgctttcagacaatgtatggctttatggaaa |
13742215 |
T |
 |
| Q |
163 |
gagaaaattggacacacgaccattgatttaggaatagccccagaaaaactagaatcctat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13742214 |
gagaaaattggacacacgaccattgatttaggaatagccccagaaaaactagaatcctat |
13742155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University