View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13438_low_5 (Length: 362)
Name: NF13438_low_5
Description: NF13438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13438_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 34850317 - 34850557
Alignment:
| Q |
1 |
aattgtaactcaactatttcaactttggtaaattccactatgattcaattaagatcaaaccaatcaaccaactagcataaaactttgctcatttgattga |
100 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34850317 |
aattgcaactcaacaatttcaactatggtaaattccactatgattcaattaagatcaaaccaatcaaccaactagcataaaactttgctcatttgattga |
34850416 |
T |
 |
| Q |
101 |
accggttggttcaatacaaatgtttaaaacatttttgcaaagcttagcataaaacttattttagttttttattcgatcaatgttaatattatgttgagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34850417 |
accggttggttcaatacaaatgtttaaaacatttttgcaaagtttagcataaaacttattttagttttttattcgatcaatgttaatattatgttgagtg |
34850516 |
T |
 |
| Q |
201 |
aggattgaacccttaacattcagagaaatgatatttgaacag |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
34850517 |
aggattgaacccttaacatt-tgagaaatgatttttgaacag |
34850557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University