View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13439_high_7 (Length: 311)
Name: NF13439_high_7
Description: NF13439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13439_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 43513751 - 43513460
Alignment:
| Q |
19 |
ttctgttgatttattcgtatgattgctctatcttttgcagagttgatggtgaagctagttgaattatgtggttcatcagtcacactgaaatgtccattac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513751 |
ttctgttgatttattcgtatgattgctctatcttttgcagagttgatggtgaagctagttgaattatgtggttcatcagtcacactgaaatgtccattac |
43513652 |
T |
|
| Q |
119 |
caaacggagatttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacgatcgcgcttcttcatcattaattcatcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43513651 |
caaacggagatttagagacattgatttcaatcaccagcgatgaagatctgaaaaatataattgaagaatacgatcgagcttcttcatcattaattcatcc |
43513552 |
T |
|
| Q |
219 |
attgaagatcagagccattctttcaccgcccaaatcattcaagaaattatctcctcctccgtcttcttcgtccagctcaactcactctctgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43513551 |
attgaagatcagagccattctttcaccgcccaaatcattcaagaaattatctcctcctccgtcttcttcgtccagctcaactcactctctgc |
43513460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 51 - 165
Target Start/End: Complemental strand, 34589665 - 34589551
Alignment:
| Q |
51 |
ttttgcagagttgatggtgaagctagttgaattatgtggttcatcagtcacactgaaatgtccattaccaaacggagatttagagacattgatttcaatc |
150 |
Q |
| |
|
||||||||| |||||||||||||| | ||||| || |||||||| || || | |||| ||||||||||||||||||||| || |||||||| ||| |
|
|
| T |
34589665 |
ttttgcagaattgatggtgaagcttgaagaattgtgcggttcatctgtgactttacggtgtcaattaccaaacggagatttagaaacgttgatttccatc |
34589566 |
T |
|
| Q |
151 |
accagcgatgaagat |
165 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
34589565 |
accaacgatgaagat |
34589551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University