View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13439_low_10 (Length: 266)
Name: NF13439_low_10
Description: NF13439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13439_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 28675714 - 28675950
Alignment:
| Q |
20 |
cgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttccttaggattaagaacatag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675714 |
cgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttccttaggattaagaacatag |
28675813 |
T |
|
| Q |
120 |
agttagactttgatcttgttcttcctctgcttttgtttgctgcatttgattttaagaatctcatcaatggtggtggaaacttttccattctacctggact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675814 |
agttagactttgatcttgttcttcctctgcttttgtttgctgcatttgattttaagaatctcatcaatggtggtggaaacttttccattctacctggact |
28675913 |
T |
|
| Q |
220 |
agaaataggttttgcagatagcttcatgatgcctttg |
256 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28675914 |
agaaatgggttttgcagatagcttcatgatgcctttg |
28675950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 40638148 - 40638109
Alignment:
| Q |
32 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40638148 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
40638109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University