View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13439_low_9 (Length: 295)
Name: NF13439_low_9
Description: NF13439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13439_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 277
Target Start/End: Complemental strand, 15176642 - 15176378
Alignment:
| Q |
13 |
aaaatgccatatcttaaagctgtgattttggaagggctaagacggcatccaccgttacactatgttgctcctcatagagtgacagaagaggttgttttaa |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
15176642 |
aaaatgccatatcttaaagctgtaattttggaagggctaaggcgtcatccaccgttgcactatgttgctcctcatagagtgaccgaagaggttgttttaa |
15176543 |
T |
 |
| Q |
113 |
atggttattcggtgcctacttttgcatctgtgaatttcttggtggctgagatagggagagatttttcggcttgggatgatcctatggcatttaagccgga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15176542 |
atggttattcggtgcctacttttgcatctgtgaatttcttggtggcggagatagggagagatttttcggcttgggatgatcctatggcatttaaaccgga |
15176443 |
T |
 |
| Q |
213 |
gaggtttatcaataatagcactttcgatataatggggagtaaagagataaagatgatgccgtttg |
277 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15176442 |
gaggtttatcaataatagtactttcgatataatggggagtaaagagataaagatgatgccatttg |
15176378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 232 - 277
Target Start/End: Original strand, 2321407 - 2321452
Alignment:
| Q |
232 |
actttcgatataatggggagtaaagagataaagatgatgccgtttg |
277 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
2321407 |
acttttgatattatagggagtaaagagataaagatgatgccgtttg |
2321452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University