View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_100 (Length: 309)
Name: NF1343_high_100
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_100 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 30744165 - 30744297
Alignment:
| Q |
1 |
ttcacattt-atgaaaattatttccttgtgtgtatctaaacatcaaggagtgttaatcaatcaattgtgctcaaataattaaggagattaaccaaatgac |
99 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
30744165 |
ttcacatttcatgaaaattaattccttgtatgtatctaaacatcaaggagtgttaaccaatcaattgtgctcaaatagttaacgagattaaccaaatgac |
30744264 |
T |
 |
| Q |
100 |
aaattgatgataatagtttaaatttgattcttg |
132 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
30744265 |
aaattgatgataataatttaaatttgattcttg |
30744297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 228 - 280
Target Start/End: Original strand, 30744309 - 30744361
Alignment:
| Q |
228 |
taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30744309 |
taggacatggtttgaatgattggcgaaggtttacctgacttccaagtcgtgtc |
30744361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University