View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_104 (Length: 297)
Name: NF1343_high_104
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_104 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 54436788 - 54436738
Alignment:
| Q |
226 |
tacattgacaaattgtccctcactcacaaatcctatttcaacagtgtcaaa |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54436788 |
tacagtgacaaattgtccctcactcacaaatcctctttcaacagtgtcaaa |
54436738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 167
Target Start/End: Complemental strand, 54436879 - 54436847
Alignment:
| Q |
135 |
ttggagaactctaacccaaattggaacaacaac |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54436879 |
ttggagaactctaacccaaattggaacaacaac |
54436847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University