View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_high_104 (Length: 297)

Name: NF1343_high_104
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_high_104
NF1343_high_104
[»] chr3 (2 HSPs)
chr3 (226-276)||(54436738-54436788)
chr3 (135-167)||(54436847-54436879)


Alignment Details
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 276
Target Start/End: Complemental strand, 54436788 - 54436738
Alignment:
226 tacattgacaaattgtccctcactcacaaatcctatttcaacagtgtcaaa 276  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||    
54436788 tacagtgacaaattgtccctcactcacaaatcctctttcaacagtgtcaaa 54436738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 167
Target Start/End: Complemental strand, 54436879 - 54436847
Alignment:
135 ttggagaactctaacccaaattggaacaacaac 167  Q
    |||||||||||||||||||||||||||||||||    
54436879 ttggagaactctaacccaaattggaacaacaac 54436847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University