View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_122 (Length: 253)
Name: NF1343_high_122
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_122 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 2251789 - 2251545
Alignment:
| Q |
1 |
ttttctttttaaatcgaaccaaaccgagacgaagagtannnnnnnnnnnnnnngtttggtttaagcattttgagggttgtttggtttatatatgaaaagt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2251789 |
ttttctttttaaatcaaaccaaaccgagacgaagagtatttttaattttttttgtttggtttaagcattttgagggttgtttggtttatatatgaaaagt |
2251690 |
T |
|
| Q |
101 |
attttattcctaattttgaagcttgtgaaacacaatagaaatagaaaagaccaagtcacataaaacattggtttttggctccaatcacgtggtcggttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2251689 |
attttattcctaattttgaagcttgtgaaacacaatagaaatagaaaagaccaagtcacataaaacattggtttttggctccaatcacgtggtcagttac |
2251590 |
T |
|
| Q |
201 |
cccttgtttgattctatttctccatccatctttccgttctctgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2251589 |
cccttgtttgattctatttctccatccatctttccgttctttgct |
2251545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University