View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_124 (Length: 251)
Name: NF1343_high_124
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 108 - 208
Target Start/End: Complemental strand, 25588182 - 25588082
Alignment:
| Q |
108 |
ttgtttcaactccattttatccgaacatgtttagtttttatatttaacttttaaaatcaaaaaattgagaccaccttgaccccttagcttttttgacaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25588182 |
ttgtttcaactccattttatccgaacatgtttagtttttatatttaacgtttgaaatcaaaaaatttagaccaccttgaccccttagcttttttgacaaa |
25588083 |
T |
|
| Q |
208 |
g |
208 |
Q |
| |
|
| |
|
|
| T |
25588082 |
g |
25588082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 25588276 - 25588209
Alignment:
| Q |
14 |
aggtggatggagtgttgatcaggagcggtggtggtagtcggcgaccactagtagtgacaagttacatt |
81 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25588276 |
aggtggatggagtgttgatcaggagcagtggtggtagtcggcgaccactagtagtgacaagttacatt |
25588209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 211 - 243
Target Start/End: Complemental strand, 31581864 - 31581832
Alignment:
| Q |
211 |
ctagctgttgcattcaaatccaatggatatttt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31581864 |
ctagctgttgcattcaaatccaatggatatttt |
31581832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 170
Target Start/End: Original strand, 15851728 - 15851778
Alignment:
| Q |
120 |
cattttatccgaacatgtttagtttttatatttaacttttaaaatcaaaaa |
170 |
Q |
| |
|
||||||| |||||||||||| ||||| | ||||||||||||||| |||||| |
|
|
| T |
15851728 |
cattttacccgaacatgttttgttttcaaatttaacttttaaaaccaaaaa |
15851778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University