View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_136 (Length: 242)
Name: NF1343_high_136
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_136 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 64 - 146
Target Start/End: Complemental strand, 33723068 - 33722986
Alignment:
| Q |
64 |
tgaatacagataagaaattttcagtttcacaacacattcgaaattgaacaagcataacaagtaataacagtaacagaatgtag |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33723068 |
tgaatacagataagaaattttcagtttcacaacacattcgaaattgaacaagcataacaggtaataacagtaacagaatgtag |
33722986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 33723143 - 33723105
Alignment:
| Q |
1 |
tgatcttccaacaccttcccacaagaagtacaaaccctg |
39 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33723143 |
tgatcttccaacactttcccacaagaagtacaaaccctg |
33723105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University