View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_137 (Length: 240)
Name: NF1343_high_137
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_137 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 38287997 - 38288216
Alignment:
| Q |
21 |
agaaacacttgcatcttgcttgatattgttgagtgaaacactttttgtgaggaatgtgatcctaaattattaacttttgattagacttcgatcgtgaaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
38287997 |
agaaacacttgcatcttgcttgatattgttgagtgaaacactttttgtgaggaatgtgatcctaaattattaacttttgattagaattcgaccgtgaaca |
38288096 |
T |
|
| Q |
121 |
ttacactttgatcttgcagatgttttataaacatgctttcatctattaataccatgacttttgtcatttgacattgcatttcattcaaaaataatgcaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38288097 |
ttacactttgatcttgcagatgttttataaacatgctttcatctattaataccatgacttttgtcatttgacattgcatttcattcaaaaataatgcaag |
38288196 |
T |
|
| Q |
221 |
cctgaatatggcttggaatt |
240 |
Q |
| |
|
|||||| | || |||||||| |
|
|
| T |
38288197 |
cctgaaaaaggattggaatt |
38288216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University