View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_139 (Length: 228)
Name: NF1343_high_139
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_139 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 72 - 228
Target Start/End: Complemental strand, 1590930 - 1590774
Alignment:
| Q |
72 |
tatgtctggggcttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcagaatcggaagtaaggcatgggaagaggaagatgttggtt |
171 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590930 |
tatgtctggggtttgggtgttcaagaatggcgtgtttcgattggtcgagaatcctcaagcagaatcggaagtaaggcatgggaagaggaagatgttggtt |
1590831 |
T |
|
| Q |
172 |
cacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1590830 |
cacttgcccacaggggaagtggtaacttcttatgcttttcttgagagaatattgatt |
1590774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 38
Target Start/End: Original strand, 31581832 - 31581864
Alignment:
| Q |
6 |
aaaatatccattggatttgaatgcaacagctag |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31581832 |
aaaatatccattggatttgaatgcaacagctag |
31581864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University