View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_147 (Length: 208)
Name: NF1343_high_147
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_147 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 11884979 - 11884848
Alignment:
| Q |
1 |
agttttactttaatcaagagttttgcatgatctgtttggaaataggaagcattatgctcaatattttaaaactcgatcttgtgtatccaaaaactcatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11884979 |
agttttactttaatcaagagttttgcatgatctgtttggaaataggaagcattatgctcaatattttaaaactcgatcttgtgtatccaaaaactcatca |
11884880 |
T |
|
| Q |
101 |
aactacactcttttgcgatacttttcatctca |
132 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
11884879 |
aactacactcttttgcgatacttttcttctca |
11884848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University