View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_high_59 (Length: 430)
Name: NF1343_high_59
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_high_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 95 - 426
Target Start/End: Complemental strand, 16065882 - 16065548
Alignment:
| Q |
95 |
acattacacgtattcagcaacatgcaatacaaattttgaaaccgttgtttacagccaacagaaaaagagaaggtagtggggactaaagactagtaggata |
194 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16065882 |
acattacacgtatccagcaacatgcaatgcaaattttgaaaccgttgtttacagccaacagaaaaagagaaggtagtggggactaaagactagtagggta |
16065783 |
T |
|
| Q |
195 |
ctttattggtcagttaatttaagggaccaatgaagcaattctttttctatatttgatgattccttagt-cctttgatggctatacaccaatcaaattaaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
16065782 |
ctttattggtcagttaatttaagggaccaatgaagcaattctttttctatatttgatgattccttggtccctttgatggttatacaccaatcaaattaaa |
16065683 |
T |
|
| Q |
294 |
aagtgtagggaagggaccacttgaattgaaatatcaaattattctgggta----tgtttgattggaatggaaaggaacgaaattaaatgggacaatgtct |
389 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16065682 |
aagtgtagggaagggaccacttgaattg--atatcaaattattctgggtatgtttgtttgattggaatggaaaggaacgaaattaaatgggacaatgtct |
16065585 |
T |
|
| Q |
390 |
agtttttaaaatgtaactaatcaacttcatctcactc |
426 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
16065584 |
agtttttaaaatgtaactaatcaatttcatttcactc |
16065548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University