View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_114 (Length: 344)
Name: NF1343_low_114
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 32 - 333
Target Start/End: Complemental strand, 43069288 - 43068987
Alignment:
| Q |
32 |
tagttttaaagatggctgctgatgttgaattgcttgtgcggaccttcgttctgttctgattttatcttcttcattttgtttgtaaatattgcatattgca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43069288 |
tagttttaaagatggctgctgatgttgaattgcttgtgcggaccttcgttctgttctgattttatcttcttcattttgtttgtaaatattgcatattgca |
43069189 |
T |
 |
| Q |
132 |
aagccattagtgtttgcactgttagcttttatactgtttgttttatgaatattttctttaggctatacttcctatatggcgtattttactcggattgttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43069188 |
aagccattagtgtttgcactgttagcttttatactgtttgttttatgaatattttctttaggctatacttcctatatggcatattttactcggattgttt |
43069089 |
T |
 |
| Q |
232 |
attggttctgcttatttttagtcactcaattgacagggacaatgtggtaggaatttactacctatgctagtccatttattgttggcactagctacgtcct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43069088 |
attggttctgcttatttttagtcactcaattaacagggccaatgtggtaggaatttattagctatgctagtccatttattgttggcactagctacgtcct |
43068989 |
T |
 |
| Q |
332 |
at |
333 |
Q |
| |
|
|| |
|
|
| T |
43068988 |
at |
43068987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University