View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_129 (Length: 312)
Name: NF1343_low_129
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_129 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 209
Target Start/End: Complemental strand, 14783024 - 14782817
Alignment:
| Q |
2 |
ctcatcaagtttactctcaaaatactatttcatccacaaaggttcaagcaaatgggtctcaacttgggttcaatgtgctggcttccctctcttgatcatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14783024 |
ctcatcaagtttactctcaaaatactatttcatccacaaaggttcaagcaaatgggtctcaacttgggttcaatgtgctggcttccctctcttgatcatc |
14782925 |
T |
|
| Q |
102 |
ccaatttttctcccttatctcttcaatctcaccaaaagaaaccctttcactgatttcacaccaaaaatgttaaccctatcaatttttgttggtatcatgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782924 |
ccaatttttctcccttatctcttcaatctcaccaaaagaaaccctttcactgatttcacaccgaaaatgttaaccctatcaatttttgttggtatcatgt |
14782825 |
T |
|
| Q |
202 |
tagggttt |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
14782824 |
tagggttt |
14782817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 6 - 75
Target Start/End: Complemental strand, 14775146 - 14775077
Alignment:
| Q |
6 |
tcaagtttactctcaaaatactatttcatccacaaaggttcaagcaaatgggtctcaacttgggttcaat |
75 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| |||||||| || | |||||| |||||||||||||||| |
|
|
| T |
14775146 |
tcaagtttactctcaaagtactattttatccataaaggttctagtagatgggtttcaacttgggttcaat |
14775077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University