View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_147 (Length: 290)
Name: NF1343_low_147
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_147 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 29 - 285
Target Start/End: Original strand, 40051764 - 40052017
Alignment:
| Q |
29 |
accttgagtaattaatcagagtgacagtcgtcacacatgagatggatcaacaccaacagacttaagagtctcagcacgaggttgataagcaaaagcatct |
128 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051764 |
accttgagtaattaataagagtgacagtc---acacatgagatggatcaacaccaacagacttaagagtctcagcacgaggttgataagcaaaagcatct |
40051860 |
T |
 |
| Q |
129 |
ctgtgaatcggactagaaacttggttatgatcaggataactacgttcctgaacatgtgcaattttcctaaagaatgaactcttaaagaatctatcagatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40051861 |
ctgtgaatcggactagaaacttggttatgatcaggataactacgttcctgaacatgtgcaattttcctaaagaatgaactcttaaagaatctatcagatt |
40051960 |
T |
 |
| Q |
229 |
cctccataacatgatcgggttccactacttcaggaacagtctctctcctttgcttct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40051961 |
cctccataacatgatcgggttccactacttcaggaacagtctctctcctttgtttct |
40052017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University