View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_149 (Length: 290)
Name: NF1343_low_149
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_149 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 232331 - 232095
Alignment:
| Q |
1 |
ttacacttttcttgtatttcctgctttttccccattaacttctcaatctgttcctcctttgacttaatctgatgattaagtttggataagtttgttttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232331 |
ttacacttttcttgtatttcctgctttttccccattaacttctcaatctgttcctcctttgacttaatctgatgattaagtttggataagtttgttttgg |
232232 |
T |
|
| Q |
101 |
ctgcagaagccctcttcttccgttcctgaatttccttttcacaatcctctgacttggatttccacttttcatattcgcccttcaactgactgatctcttt |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
232231 |
ctgcagaagccctcttcttcagttcctgaatttccttttcacaatcctctgacttggatttccacttttcatattcacccttcaactgactgatctcttt |
232132 |
T |
|
| Q |
201 |
attagcattctccgctgctaactttgcttcggcctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
232131 |
attagcattctccgctgctaactttgcttcggcctct |
232095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 74 - 166
Target Start/End: Complemental strand, 30591830 - 30591738
Alignment:
| Q |
74 |
gattaagtttggataagtttgttttggctgcagaagccctcttcttccgttcctgaatttccttttcacaatcctctgacttggatttccact |
166 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||||| ||||||||| |||||| ||||||||||||| |||||||| || |||||||||| |
|
|
| T |
30591830 |
gattaagtttggctaagcttgttgtggctgcagaagccttcttcttccattcctggatttccttttcacgatcctctgcctctgatttccact |
30591738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 166
Target Start/End: Complemental strand, 25841750 - 25841698
Alignment:
| Q |
114 |
cttcttccgttcctgaatttccttttcacaatcctctgacttggatttccact |
166 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
25841750 |
cttcttccattcctgggtttcctcttcacaatcctctaactttgatttccact |
25841698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University