View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_151 (Length: 277)
Name: NF1343_low_151
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_151 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 15720451 - 15720624
Alignment:
| Q |
1 |
cctcttctagtatgcaccttggtatttttatattactagcgaattgatggagcaaatcaagaaggctaacaagaggatcaatatctaaaggactagagag |
100 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
15720451 |
cctcttttagtatgcaccttgatatttttatattactagcgaattgatggagcaaatcaagaaggttaacaagaggaccaatatctaaaggactagagag |
15720550 |
T |
 |
| Q |
101 |
cactgataaaatattcttccattcaaagatagagttggagcctaatgtgtcataattgaggaagacgaatcttg |
174 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15720551 |
cactgataaaatactcttccattcaaagatagagttgcagcctaatgtgtcataatagaggaagacgaatcttg |
15720624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University