View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_158 (Length: 263)
Name: NF1343_low_158
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_158 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 14783001 - 14783245
Alignment:
| Q |
1 |
tattttgagagtaaacttgatgaggttgaaccaacaaagagtaagagaaagttgattatcaaaagtggcatgtaccttttgtttgtaatggatttttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14783001 |
tattttgagagtaaacttgatgagattgaaccaacaaagagtaagagatagttgattatcaaaagtggcatgtaccttttgtttgtaatggatttttgat |
14783100 |
T |
 |
| Q |
101 |
catttgcatgcaggtggtttttgttgttgacaaatggtgatggttgattttgatgttgttgtgtttcttcttcttgatgatcaatggcttcaatgtcaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14783101 |
catttgcatgcaggtggtttttgttgttgacaaatggtgatggttgattttgatgttgttgtgt---ttcttcttgatgatcaatggcttcaatgtcaat |
14783197 |
T |
 |
| Q |
201 |
tgtgtcttctttgttggtagggttcatggtgagagattgatgatgatg |
248 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14783198 |
tgtgtcttcattgttggtagggttcgtggtgagagattgatgatgatg |
14783245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University