View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_160 (Length: 261)
Name: NF1343_low_160
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_160 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 38 - 242
Target Start/End: Original strand, 41849914 - 41850118
Alignment:
| Q |
38 |
acaaatttgaatgtcttggttattttacatgaagtaagcaatggtataaaatgaagagaaagaaatgaaagagagcgagaccagagcaagtgattgtgaa |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| || |
|
|
| T |
41849914 |
acaaatttgaatgtcttggttattttacatgaagtaagcaatggtataaaatgaagagaaagaaatgaaatagagtaagaccagagcaagtgattgtaaa |
41850013 |
T |
 |
| Q |
138 |
gggtaaagcagaagtggtgaaacatggtcgtttggttgagtagttgcgtatggccaaactggttcgtgggagttgaattgaaaggttggccattcttctc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41850014 |
gggtaaagcagaagtggtgaaacatggtcgtttggttgagaagttgcgtatggacaaacttgttcgtgggagttgaattgaaaggttggccattcttctt |
41850113 |
T |
 |
| Q |
238 |
tctgc |
242 |
Q |
| |
|
||||| |
|
|
| T |
41850114 |
tctgc |
41850118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University