View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_165 (Length: 252)
Name: NF1343_low_165
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_165 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 17806201 - 17806394
Alignment:
| Q |
16 |
atactttaaagtttacatgaattggaccaagaccaaataagagatgtggaatttatcacatgttagatcttagtcccaaaacttta-ttatttggataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
17806201 |
atactttaaagtttacatgaattggaccaagaccaaataagagatgtgaaatttatcacatgttagatcttagtctcaaaactttatttttttggataaa |
17806300 |
T |
 |
| Q |
115 |
ataaagtgtgtctacgtgcaactgtgaagactaattcttcgaggtaacacaaatatatttaagagattgacttcttctaacatatgtttttccaca |
210 |
Q |
| |
|
||||||||| |||||||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
17806301 |
ataaagtgtatctacgtgcaaccgtaaagactaattcttcgaggtaacataaatatatttaagagattgacttctcctaac--atgtttttccaca |
17806394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 215 - 247
Target Start/End: Complemental strand, 31581864 - 31581832
Alignment:
| Q |
215 |
ctagctgttgcattcaaatccaatggatatttt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31581864 |
ctagctgttgcattcaaatccaatggatatttt |
31581832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University