View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_176 (Length: 251)
Name: NF1343_low_176
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_176 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 946418 - 946470
Alignment:
| Q |
190 |
ttaacaatttgtttgattttcagggaagcatgcattccatcaatgatattatt |
242 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
946418 |
ttaacaatttgattgattttcagggaagcatgcattccatcaatgatattatt |
946470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University