View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_180 (Length: 243)
Name: NF1343_low_180
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_180 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 33723119 - 33723273
Alignment:
| Q |
1 |
cttgtgggaaggtgttggaagatcagattttaactgaggagcccacttttactaaaaactccgccggacaggtaactgaagttttttagggtatgggcnn |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
33723119 |
cttgtgggaaagtgttggaagatcagattttaactgaggagcccacttttactaaaaactccgccggacaggtaacttaag-tttttagggtatgggctt |
33723217 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnnagggtagaggaatttaaggttaaaaatcaaattgatgatgt |
156 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33723218 |
tttttgtttttgtttagggtagaggaatttgaggttaaaaatcaaattgatgatgt |
33723273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University