View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_181 (Length: 243)

Name: NF1343_low_181
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_181
NF1343_low_181
[»] chr4 (2 HSPs)
chr4 (1-80)||(15340588-15340667)
chr4 (155-230)||(15340439-15340514)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 15340667 - 15340588
Alignment:
1 agagttcgctcttggtcttgttgctggtggattagtcgacgggaatattgatctttggaatcctcttagtctgattcggt 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15340667 agagttcgctcttggtcttgttgctggtggattagtcgacgggaatattgatctttggaatcctcttagtctgattcggt 15340588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 15340514 - 15340439
Alignment:
155 atggattgtgaattgattgaagatatggtttagtatcggtgattcagagaagtagaaatgtttgtttggacgatat 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15340514 atggattgtgaattgattgaagatatggtttagtatcggtgattcagagaagtagaaatgtttgtttggacgatat 15340439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University