View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_181 (Length: 243)
Name: NF1343_low_181
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_181 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 15340667 - 15340588
Alignment:
| Q |
1 |
agagttcgctcttggtcttgttgctggtggattagtcgacgggaatattgatctttggaatcctcttagtctgattcggt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15340667 |
agagttcgctcttggtcttgttgctggtggattagtcgacgggaatattgatctttggaatcctcttagtctgattcggt |
15340588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 15340514 - 15340439
Alignment:
| Q |
155 |
atggattgtgaattgattgaagatatggtttagtatcggtgattcagagaagtagaaatgtttgtttggacgatat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15340514 |
atggattgtgaattgattgaagatatggtttagtatcggtgattcagagaagtagaaatgtttgtttggacgatat |
15340439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University