View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_182 (Length: 242)

Name: NF1343_low_182
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_182
NF1343_low_182
[»] chr7 (2 HSPs)
chr7 (64-146)||(33722986-33723068)
chr7 (1-39)||(33723105-33723143)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 64 - 146
Target Start/End: Complemental strand, 33723068 - 33722986
Alignment:
64 tgaatacagataagaaattttcagtttcacaacacattcgaaattgaacaagcataacaagtaataacagtaacagaatgtag 146  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
33723068 tgaatacagataagaaattttcagtttcacaacacattcgaaattgaacaagcataacaggtaataacagtaacagaatgtag 33722986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 33723143 - 33723105
Alignment:
1 tgatcttccaacaccttcccacaagaagtacaaaccctg 39  Q
    |||||||||||||| ||||||||||||||||||||||||    
33723143 tgatcttccaacactttcccacaagaagtacaaaccctg 33723105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University