View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1343_low_183 (Length: 240)

Name: NF1343_low_183
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1343_low_183
NF1343_low_183
[»] chr1 (1 HSPs)
chr1 (21-240)||(38287997-38288216)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 38287997 - 38288216
Alignment:
21 agaaacacttgcatcttgcttgatattgttgagtgaaacactttttgtgaggaatgtgatcctaaattattaacttttgattagacttcgatcgtgaaca 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||    
38287997 agaaacacttgcatcttgcttgatattgttgagtgaaacactttttgtgaggaatgtgatcctaaattattaacttttgattagaattcgaccgtgaaca 38288096  T
121 ttacactttgatcttgcagatgttttataaacatgctttcatctattaataccatgacttttgtcatttgacattgcatttcattcaaaaataatgcaag 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38288097 ttacactttgatcttgcagatgttttataaacatgctttcatctattaataccatgacttttgtcatttgacattgcatttcattcaaaaataatgcaag 38288196  T
221 cctgaatatggcttggaatt 240  Q
    |||||| | || ||||||||    
38288197 cctgaaaaaggattggaatt 38288216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University