View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1343_low_184 (Length: 235)
Name: NF1343_low_184
Description: NF1343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1343_low_184 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 225
Target Start/End: Original strand, 10379060 - 10379189
Alignment:
| Q |
96 |
gtttggtgctctcatacaacccttttctgatttagattatcatgttaacatgatacatgcacttgatctctgttgtgtcaatggcatagtatagatgctg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10379060 |
gtttggtgctctcatacaacccttttctgatttagattatcatgttaacatgatacatgcacttgatctctgttgtgtcaatggcatagtatagatgctg |
10379159 |
T |
|
| Q |
196 |
acattctcaaaggaaggtccatgttctctg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10379160 |
acattctcaaaggaaggtccatgttctctg |
10379189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University